idkdeirdre idkdeirdre

18-03-2021
Mathematics

contestada

what is X please help 5x - 13.75 = 20

Respuesta :

baldishkaur309 baldishkaur309

18-03-2021

Answer:

X= 1.25

13.75 + 5= 18.75

20 - 18.75= 1.25 OR 1.25 + 18.75 = 20

Step-by-step explanation:

Answer Link

Otras preguntas

What was Okonkwo point of view in 'When Things Fall Apart' and how did he develop through the story?

A dance instructor wants 8 costumes to be yellow and 24 costumes to be blue. What is the ratio of blue costumes to yellow costumes?

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

How did the impact of the European Renaissance differ from the impact of the Protestant Reformation

Suppose the radius of a circle is 3 What is its circumference? Either enter an exact answer in terms of and enter your answer as a decimal.

which of the following is the best description of Joe's attitude when he reaches Eatonville?

Why do you think Adams & Jefferson both had their support concentrated in particular regions of the country? REWARDING BRAINLIEST ANSWER

can some one please explain to me how to do this problem 7x+3(x-2)-4x+8

A cone-shaped tent has a diameter of 12 ft and a height of 6 ft. What is the approximate volume of the tent? Use 3.14 to approximate pi, and express your fina

What planet weighs over twice as much as all the other known planets combined?