hdiaz931
hdiaz931 hdiaz931
  • 22-02-2017
  • Biology
contestada

Part 1: CCATAGCACGTTACAACGTGAAGGTAA
Convert it into RNA
List Amino Acids and do the same with
CCGTAGCATGTTACAACGCGAAGGCAC
thanks :3

Respuesta :

dana1321 dana1321
  • 23-02-2017
RNA--GGUAUCGUGCAAUGUUGCACUUCCAUU
Answer Link
ACCESS MORE

Otras preguntas

Can someone please help me with Spanish masculine and feminine
five words that contain the greek latin root/affix
an assembly line produces 20 items per hour. if the line runs 24 hours per day, 7 days week, how many items are made by this machine in one month? (assume 30 da
what is environmental geography?
most puerto ricans would prefer to be their own independent nation, separate from the us.
if only 10% of the 200 apples were bad what percent is that
what is the comparative form of the adjective extraordinary?
what invention helped farmers prevent cattlemen from driving herds through their farm
what does the ghost tell hamlet? what order does he give him? why must hamlet leave his mother alone?
Jennifer normally experiences a flood of romantic feelings whenever she smells a particular cologne because it reminds her of her boyfriend. Thankfully, when he