hdiaz931 hdiaz931

22-02-2017
Biology

contestada

Part 1: CCATAGCACGTTACAACGTGAAGGTAA
Convert it into RNA
List Amino Acids and do the same with
CCGTAGCATGTTACAACGCGAAGGCAC
thanks :3

Respuesta :

dana1321 dana1321

23-02-2017

RNA--GGUAUCGUGCAAUGUUGCACUUCCAUU

Answer Link

Otras preguntas

Using the text below, select the best summary of what the author accomplished in this section from the answer choices. I lived at West Egg, the—well, the less f

An object is moving along a straight line. The graph shows the velocity of the object over time. Velocity (m/s) 11 10- 9. 3 2- 10 11 Time (s) During which time

A bee hummingbird has a mass of 0.0023 kilogram. What is the mass of a bee hummingbird written in scientific notation?

When opening a new scene in PlayCanvas, which of the following objects in automatically included

Match each example with a type of figurative language. The sun smiled brightly as she rose above the clouds. I am so tired I could sleep for a year. Rain drops

They made two mistakes in the following work, below, explain their mistakes in the box below: 26 - 8 x 2 + 6 /3 18 x 2 + 6/3 36 + 6/3 42/3 14

Festivals were scattered throughout the year, as many as pebbles on the shore, but this festival was a special one. Which of these has most nearly the same mea

The FIFA World Cup, often simply called the World Cup, is an international association football competition contested by the senior men's national teams of the

What is the definition of a square, in 2 words?

The U.S. announces more water cuts as Colorado River hits dire lows write a summary about this article

ACCESS MORE EDU ACCESS