haleybair25 haleybair25

16-12-2020
Mathematics

contestada

solve 4x - 7 < 7 or -2x + 13 < 5

Respuesta :

tpee645 tpee645

16-12-2020

Answer:

1. x<7/2

2. x>4

Step-by-step explanation:

hope this helps

Answer Link

Otras preguntas

A 45 L container holds 28 moles of gas at a temperature of 215 K. What is the pressurein atmospheres inside the container?

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

Larsen Corporation reported $200,000 in revenues in its 2020 financial statements, of which $66,000 will NOT be included in the tax return until 2021. The enact

art of the negotiation with the investment banker during the selection process has to do with how the investment banker will be compensated for taking the compa

Two Δ are similar. The sides of the first Δ are 2,4,6. The largest side of the second Δ is 24. Find the perimeter of the second Δ.

–64 = 4= ? Plz dont guess

*. Find the volume of a cone with a 6-inchradius and a height of 10 inches.

Powell Warehouse distributes hardback books to retail stores and extends credit terms of 4/10, n/30 to all of its customers. During the month of June, the follo

What set of reaction conditions would favor an SN1 reaction on 2-bromo-3-methylbutane? strong nucleophile in an aprotic solvent weak nucleophile in a protic sol

Constants | Periodic Table Suppose your biking partner claims that hyperventilating at the bottom of steep hill climbs is a good idea because it will "increase

RELAXING NOICE