Respuesta :
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
The complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT is as follows: TTAAGCGGCCATAATCTGCAA
DNA:
- DNA is a biological molecule that stores genetic information in living cells.
- DNA is structurally made up of monomers called nucleotides, which is further made up of three components namely: pentose sugar, phosphate group and nitrogenous bases.
- The nitrogenous base in DNA are: adenine, cytosine, thymine and guanine. Adenine pairs with Thymine while Guanine pairs with Cytosine i.e. A-T, G-C.
- Therefore, the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT is as follows: TTAAGCGGCCATAATCTGCAA.
Learn more about complementary DNA at: https://brainly.com/question/13049777?referrer=searchResults
Otras preguntas
