Which correctly describes a cross section of the right rectangular prism if the base is a rectangle measuring 15 inches by 8 inches? Select three options.. A right rectangular prism with length 15 inches, width of 8 inches, and height of 6 inches. A cross section parallel to the base is a rectangle measuring 15 inches by 8 inches. A cross section parallel to the base is a rectangle measuring 15 inches by 6 inches. A cross section perpendicular to the base through the midpoints of the 8-inch sides is a rectangle measuring 6 inches by 15 inches. A cross section perpendicular to the base through the midpoints of the 8-inch sides is a rectangle measuring 4 inches by 15 inches. A cross section not parallel to the base that passes through opposite 6-inch edges is a rectangle measuring 6 inches by greater than 15 inches. i will give brainly.

Question

s914693 s914693

29-04-2020
Mathematics

contestada

Which correctly describes a cross section of the right rectangular prism if the base is a rectangle measuring 15 inches by 8 inches? Select three options.. A right rectangular prism with length 15 inches, width of 8 inches, and height of 6 inches. A cross section parallel to the base is a rectangle measuring 15 inches by 8 inches. A cross section parallel to the base is a rectangle measuring 15 inches by 6 inches. A cross section perpendicular to the base through the midpoints of the 8-inch sides is a rectangle measuring 6 inches by 15 inches. A cross section perpendicular to the base through the midpoints of the 8-inch sides is a rectangle measuring 4 inches by 15 inches. A cross section not parallel to the base that passes through opposite 6-inch edges is a rectangle measuring 6 inches by greater than 15 inches. i will give brainly.

Respuesta :

Otras preguntas

58. What is the equation that best represents the graph (0,5) (3, 3) (6, 1)

General kinematics problem."Anna is returning from vacation driving down the Sunshine Highway. She travels for a stretch (SA) at a speed of 110 km/h. Then, due

I want a way to solve this question

Sheila has $46 to buy graphing pads for her math class. Each pad costs $8. How many pads can she buy? Do not include units in your answer.

A block has 73 kg is being pushed and accelerated at rate of 10 m/s. what force is being applied to the block? 730 N 7.3 N 7300 N 730 Kg

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

What could English women colonists not do after they got married? O A. They could not own property. B. They could not work. O C. They could not go outside the h

How do you write 2/5 as a percentage

Explain how natural disasters can change the characteristics of a species for many generations after the disaster. To develop this discussion you will need a mi

how to calculate velocity with acceleration and time

ACCESS MORE EDU ACCESS

nabiwillow nabiwillow · Answer 1 · 2020-05-06T21:56:49+02:00

Answer:

A cross section parallel to the base is a rectangle measuring 15 inches by 8 inches

A cross section perpendicular to the base through the midpoints of the 8-inch sides is a rectangle measuring 6 inches by 15 inches.

A cross section not parallel to the base that passes through opposite 6-inch edges is a rectangle measuring 6 inches by greater than 15 inches.

Step-by-step explanation:

I took the quiz

Lanuel Lanuel · Answer 2 · 2022-05-05T13:42:47+02:00

The statements which correctly describes a cross section of the right-rectangular prism if the base is a rectangle measuring 15 in. by 8 in. are: B, D and F.

The surface area of a rectangular prism.

Mathematically, the surface area of a right-rectangular prism is calculated by using this formula:

A = 2(wl + hl + hw)

Where:

A is the surface area.

l is the length.

w is the width.

h is the height.

Based on the surface area of this right-rectangular prism, we can deduce the following points:

A cross-sectional area that is parallel to the base is a rectangle which measures 15 inches by 8 inches.

A cross-sectional area that is perpendicular to the base through the midpoints of the 8-inch sides is a rectangle whch measures 6 inches by 15 inches.

A cross-sectional area that is not parallel to the base and passes through opposite 6-inch edges is a rectangle whch measures 6 inches by greater than 15 inches.

Read more on rectangular prism here: brainly.com/question/3867601

#SPJ2