granniejo granniejo
  • 28-03-2018
  • Mathematics
contestada

What is the probability of rolling an even number on a standard six sided number cube 25 times?

Relax

Respuesta :

Rabin
Rabin Rabin
  • 28-03-2018
the answer is 75/150
Answer Link
rvyanes
rvyanes rvyanes
  • 28-03-2018
all you have to do is multiply 25 and 3. the three is how many even numbers there are on a six-sided cube. so the answer would be...75. hope this helps
Answer Link

Otras preguntas

Where did the majority of people t ravel from who were heading to make a new life out of the west?
How did the Hellenistic kings spread Greek culture
Towards the end of Anne's diary, her entries stop being about her relationship with Peter and focuses more on what? the burglaries in the house the food
What did Jimmy Carter base his views on foreign-policy?
how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x
The vessels that are responsible for carrying blood away from the heart are
I need help on exterior angles!
In the adult, the internal reproductive organs and the urinary bladder are "housed" in which body cavity?
What is the value of x?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat