Replication
of the following DNA segment will be the following:
5’ agcgggatgagcgcatgtggcgcataactg3’
3’ tcgccctactcgcgtacaccgcgtattgac5’
3’ tcgccctactcgcgtacaccgcgtattgac5’
5’ agcgggatgagcgcatgtggcgcataactg3’
When DNA replication begins, the two parent or main DNA strands are
being separated. The first one is called the leading strand, which is replicated
in a 3’ to 5’direction in a continuous manner. The other strand, which is known
as the lagging strand, runs in the 5’ to 3’ direction. Once the DNA strands
have been separated, they’ll be held apart and then new nucleotide partners
will be bonded to each other thru hydrogen bonding. With the diagram above,
remember the pairing rules: Adenine (A) partners with Thymine (T) and Cytosine
(C) partners with Guanine (G).
