19-01-2016
English

contestada

define forceful language

Respuesta :

WorldlyGlass49 WorldlyGlass49

19-01-2016

Forceful language is language intended to intimidate or forcefully persuade a person with whom you're speaking. It can even include curse words, or can include different intonation elements such as yelling.

Answer Link

Otras preguntas

7. Error Analysis: Identify and explain the error the student made when writing the equation of the graph below. y = |x +31 el

Consider the following quadratic equation. Find the real zeros, if any, of this function. Reduce all fractions to lowest term.

I don't quite get this question, it will be greater if you can explain it

Change any nucleotide between the Reading Frame (Between 'Start' and 'STOP' transcribing 5’ acgatgcattgtcccgcactgtaatat3’ 3’ tgctacgtaacagggcgtgactgcattata5’

What is the balanced net ionic equation of mixed AgNO3 and MgCl2 solutions?Ag+(aq) + Cl2–(aq) → AgCl2(s)Mg2+(aq) + NO3–(aq) → Mg(NO3)2(s)Ag3+(aq) + 3Cl–(aq) → A

B In right triangle ABC, m_B+ m_C Let sin B = x and cos B =y. What is sin C- cos CP

Decide whether triangles ABC and DEC are similar. Explain or show your reasoning.

Is (x-3) a factor of f(x) = x^2 - 32?

4. The table represents a proportional relationship. Find the constant ofproportionality and write an equation to represent the relationship.aу23110103124Consta

Please I would like to have the answer for number 8

ACCESS MORE EDU ACCESS