eithumanzor89 eithumanzor89

01-03-2018
Physics

contestada

What have been the first step in forming the solar system

Respuesta :

01-03-2018

Well the first step in forming the solar system wad a cloud of gas and dust in space was disturbed, maybe by the explosion of a nearby star (supernova). That explosion made waves in space which squeezed the cloud of dust and gas.

Answer Link

Otras preguntas

In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y

The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Did feudalism create a stable form of government?

Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa

Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your

Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12

what is 15/24 in simplest form

Give a recursive algorithm for ﬁnding the sum of the ﬁrst n odd positive integers.

The type and age of rocks found in the mountain range are also found on another continent. What might this mean?