26-10-2015
Mathematics

contestada

find a sum equivalent to the product 6(y + x)

Respuesta :

calummonk65 calummonk65

26-10-2015

6y+6x
all you do is the distributive property

Answer Link

Otras preguntas

Identify the subordinate clause in the sentence below. Identify it as a noun clause or an adjective clause. The cat that is sitting in the window weighs twenty-

what are themes explored in Beowulf

A man parked his car in a carpark at 08 30 and retrieved it at 15 45 on the same day. If the parking charges are $1.50 for the first hour and 80 cents for each

Which of these sentences would be most effective in establishing a humorous tone? A. Going to the dentist is not as bad as people imagine. It’s worse. B. I am

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

What is an aesthetic distance?

A window shaped like a parallelogram has an area of 18 1/3 square feet. The height of the window is 3 1/3 feet. How long is the base of the window?

Better wages, entertainment, and opportunities for advancement drew many people to the cities. a. True b. False

Energy firm the sun is transferred to earth trough convection

Which of the following would increase friction? A. Motor oil B. Sand C. Soap D. Water