To determine the number of Alanine molecules present in a polypeptide containing 8 amino acids coded for by the given DNA template, we need to follow these steps:
1. Transcribe the DNA template into mRNA:
The complementary mRNA sequence for the given DNA template is:
AGCCGGAUGGCCCGGGUACGGUUA
2. Identify the mRNA codons for Alanine (Ala):
The mRNA codon for Alanine is GCC.
3. Count the number of occurrences of the codon GCC in the mRNA sequence:
In the mRNA sequence
AGCCGG**AUGGCC**CGGGUACGGUU
A, there is one occurrence of the codon GCC.
4. Calculate the total number of Alanine molecules:
Since there is one occurrence of the codon GCC, there is one Alanine molecule present in the polypeptide chain.
Therefore, there is one Alanine molecule present in the polypeptide containing 8 amino acids coded for by the given DNA template.
