Seudónimo Seudónimo

16-05-2017
Mathematics

contestada

Rosa scored 174,325 points playing a video game.

To the nearest ten thousand, about how many points did Rosa score?

Respuesta :

cclark354914 cclark354914

16-05-2017

170,000
7 is in the 10 thousands decimal place
4 is less than 5, so you round down.

Answer Link

idonthaveausername idonthaveausername

16-05-2017

The answer is 170,000.

Answer Link

Otras preguntas

Sage Company is operating at 90% of capacity and is currently purchasing a part used in its manufacturing operations for $18.00 per unit. The unit cost for the

What is the best website to watch American Tv shows & movies outside the country ?

help please i’ll mark brainliest

write a poem using your memories on a place you visited you could also start your poem with i remember allow your memories to guide your pen

The width of a rectangle is twice as long as the length. if the length is increased by 50% and the width is decreased by 20%, the perimeter becomes 248. find th

Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed f

A line passes through the point (5,6) and is parallel to the line given by the equation y = 2x - 12. Which of these is an equation for the line? O A. y-5=-264-6

Most physical characteristics are inherited. Scientists have discovered several genes that contribute to human fatness, particularly genes that regulate the pro

the Americans with Disabilities Act (ADA) of 1990 determines what qualifies as Group of answer choices fair treatment for a person with a disability. bona fide

. A nonfinancial performance measure is often used to evaluate the __________ of a business activity. time quality quantity All of these choices are correct. 2.

RELAXING NOICE