sar5apingSh4awkinz sar5apingSh4awkinz

20-04-2017
Computers and Technology

contestada

What the official coding language of batch files?

Respuesta :

Аноним Аноним

20-04-2017

shell's language. that's why it is called shell script

Answer Link

abdubasheer abdubasheer

20-04-2017

Shell script is your answer. if you want to learn more go here. https://en.wikipedia.org/wiki/Shell_script

Answer Link

Otras preguntas

you are purchasing a car for 12,465 plus 5.65% sales tax you make a 1,300 down payment you have a fair credit score how much interest is due at the end of the f

what does " what is the topic or event being described " mean

What causes effervescence ?

How does capillarity help sustain life? a. Plants use capillarity to move water from their roots to their leaves. b. Capillarity allows water to form droplets.

Write a brief letter to the editor of a European newspaper expressing what your views might have been about the coming war.

Which of the following does NOT need to be included in the body of a persuasive essay? A. examples and details B. arguments for your position C. your thesis sta

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Creating new jobs, inventing new products, and opening new stores are actions of a(n) _____. a.) consumer b.) entrepreneur c.) homeowner

how can i find tje percent of 27% of 675

Why is the Nile river considered a gift?

ACCESS MORE EDU ACCESS