CarolineJayamaha CarolineJayamaha

18-09-2022
Mathematics

contestada

What is the correct name for this plane? (look to ss)

A. plane AJC

B. plane A

C. plane ABC

D. plane AB

What is the correct name for this plane look to ss A plane AJCB plane AC plane ABCD plane AB class=

Respuesta :

trannhankl2001 trannhankl2001

18-09-2022

Answer:

a. plane AJC

Step-by-step explanation:

In order to name a plane, you need to name at least 3 points in that plane, which are not in line.

Answer Link

Otras preguntas

(A) Develop the activity sequence model and determine the normal time for the following work activity: An assembly worker on a production line obtains an Allen

How could a quadrilateral be a parrallelogram A.one pair of sides is parallel and one pair of angles is congruent B.one pair of sides is congruent and one pair

E21A1. (Lessee Entries; Finance Lease with No Residual Value) (LO 1, 4) DU Journeys enters into an agreement with Traveler Inc. to lease a car on December 31,

Sean wrote the equation 9.25 = 5m, where m is the cost per pound, to show the relationship between the total cost, $9.25, and the number of pounds of pears, 5,

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

A circle has its center at (-2-3) and a radius of 3 units What is the equation of the circle 1 point x-2-y-32 = (x - 2)2 + (y - 3)2 = 3 6x +212 + y + 3)2 = 2 (x

Which of the following is TRUE concerning sampling errors? a. The degree of sampling error can be estimated. b. Sampling errors are frequently the most importan

You are the CFO of a US firm whose wholly owned subsidiary in Mexico manufactures component parts for your U.S. assembly operations. The subsidiary has been fin

If the Supreme Court decides a case based on substantive due process, what is it determiningA whether the 5th Amendment is fairB whether the 14th Amendment is f

I In your business, assets, and liabilities have historically varied with sales. Assets are usually 82 percent of sales, and liabilities are usually 54 percent