jalaycia1320 jalaycia1320
  • 28-09-2021
  • Spanish
contestada

Translate the lights into Spanish in the box below:

Respuesta :

vane005 vane005
  • 28-09-2021
the translation is "las luces"
Answer Link

Otras preguntas

A number is chosen at random from 1 to 25. Find the probability of selecting a number less than 2
Rafael is analyzing data about the price of a certain stock in his finance class. He finds the linear regression line for the data to be f(x) = 0.76x + 42.39, w
Which racial-ethnic group is less likely to date someone of their own race-ethnicity than would be expected if dating was completely unrelated to race-ethnicity
4 out of 9 dogs weigh less than 20 pounds what is the decimal equivalent to the number of dogs weighing under 20 lb
A 60 kg driver gets into an empty taptap to start the day's work. the springs compress 1.5Ã10â2 m . what is the effective spring constant of the spring system i
If 17y-24y+13y=210+y, what is the value of y?
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
for the function y=x^2+5, find the average rate of change over the interval -2≤x≤6
Please help quick What are the solutions of the system? {y=2x+6 y=x^2+5x+6
Which of the following is an organic compound
ACCESS MORE
EDU ACCESS