millietaylor07 millietaylor07

18-08-2021
Mathematics

contestada

Malachy and Paul win some money and share it in the ratio 2:1. Malachy gets £24
more than Paul. How much did they get altogether?

Respuesta :

tieungocmaihsgs2017 tieungocmaihsgs2017

18-08-2021

Step-by-step explanation:

Malachy's money = 2x

Paul's money = x

=> 2x - x = 24 => x= 24

Total money = 3x = 72

Answer Link

Otras preguntas

Select the correct answer from each drop-down menu. Angie goes diving in the sea. 1 -Anguilliformes Perciformes Gadiformes 2-salmoniformes Clupeiformes Sphenis

what do people traditionally put on top of a christmas tree?

Emma puts $10,000 in a simple interest account at a bank. She will earn $1,800 in 4 years. What is the annual interest rate for the account?.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

The ability to produce novel and valuable ideas is called:

Chlorophyll, the primary photosynthetic pigment, emits light in the red region of the visible spectrum. The presence of chlorophyll correlates with photosynthet

A block has 73 kg is being pushed and accelerated at rate of 10 m/s. what force is being applied to the block? A-730 N B-7.3 N C-7300 N D-730 Kg

Answer the questions below to find the total surface area of the can. (55 points, help fast)

The total area of two square windows is 1,025 in. 2. Each side of the larger window is 5 in. Longer than the sides of the smaller window. How long are the sides

What is the counter example for the conditional below? if a number is divisible by 6, then it is divisible by 18.