clairereister79 clairereister79
  • 17-08-2021
  • Biology
contestada

What controls the heart rate in the human body

Respuesta :

tayloreritch48 tayloreritch48
  • 17-08-2021

Answer: the nerve system

Explanation:

Answer Link
christianaukpabio01
christianaukpabio01 christianaukpabio01
  • 17-08-2021

Answer:

Heart rate is controlled by the two branches of the autonomic (involuntary) nervous system. The sympathetic nervous system (SNS) and the parasympathetic nervous system (PNS)

Explanation:

The sympathetic nervous system (SNS) releases the hormones (catecholamines - epinephrine and norepinephrine) to accelerate the heart rate

I hope this help you

Answer Link

Otras preguntas

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Kinnikinnick is a native american herbal mixture used as a substitute for what?
What does the medical term bradying down mean?
Would fibrous and cartilaginous joints be able to perform their functions if they had joint cavities? Explain.
What does cuales son las horas de esa farmacia mean in english
HELPP ASAP PLEASEEEE!!!!!!!!!!!!!!!!! Why do you think latin music had such a great influence on the development of popular music?
Which of the following words most likely indicates a wrong answer in the answer choices? Occasionally, Might, Always, Sometimes?
the structure that stores maturing sperm until they are released by the male reproductive system is the vas deferens epididymis penis urethra
Flip the camera like that?
Help me with these questions thank you use words at top b