shivprashad493 shivprashad493

02-08-2021
Mathematics

contestada

what is the value of g

Respuesta :

Abhinavgeats98 Abhinavgeats98

02-08-2021

Answer:

the value of g is gram .

may this answer is helpful for you

Answer Link

00063272 00063272

02-08-2021

Answer:

g

Step-by-step explanation:

g

Answer Link

Otras preguntas

Hello there, to start off. I am BLIND literely and can't read the graphics on the website so the information about how to answer these problems needs to be writ

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Determine a series of transformations that would map Figure 1 onto Figure J. y 11 Figure J NOW ona 00 05 15 1 -12-11-10-9-8-7-6 -5 -4 -3 -2 -1 1 2 3 4 5 6 7 8 9

Jerry and Steve each had 24 candy bars to sell. Jerry sold 50% of his candy bars. Steve sold of his candy 6 bars. What fraction of the total candy bars did Jerr

V8 to the nearest tenth is about ?

At what point do they intersect Round to 2 decimal places.

In the image below, line ris perpendicular to both lines p and q. Lines p and p and r. are parallel to one another. Transversal s goes through lines p 28° s Wha

The slope of the line is 2 and goes through the point (-8,6)

I need help question

If two terms of an arithmetic sequence are a11 = 31 and a15 = −1, what is a28? −193 −185 −105 −2