19-07-2021
Mathematics

contestada

Fill in the missing statements and reasons in the proof

Fill in the missing statements and reasons in the proof class=

Respuesta :

sryan29 sryan29

19-07-2021

Answer:

1. Given

2. Vertical angle theorem

3. AB≅DB, EB≅CB, m<ABC≅m<DBE

4. △ABC ≅ △DBE

Hope this helps :D

Answer Link

Otras preguntas

How does the cycle of satisfaction work? How can the firm improve the design and fit of products?

Each heart contraction begins in a small group of cardiac muscle cells called the _______ node?

What is the explicit rule for the nth term of the geometric sequence? 3, 18, 108, 648, 3,888, … A.an = 3(6n) B.an = 3(6n + 1) C.an = 6(3n – 1) D.an = 3(6n – 1)

Each of the following falls into the category of bank assets except:A. loans.B. investment securities.C. demand deposits.D. cash and due from banks.E.other asse

Which one of the following plume behavior occurs when atmospheric inversion begins from the ground level and continues A) Ground-level Inversion B) Lapse Rate I

topic sentence with burger

What is the force experienced by a positive test charge of 6.4 × 10^(-6) coulombs if the electric field strength is 2.8 × 10^5 newtons/coulomb? a) 6.4 × 10^(-6)

Which of the following is grounds for disciplinary action according to ABRET's Code of Ethics?A.Refusing primary responsibility for interpretation of a study.B.

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT

A nurse is talking with the guardian of a 4-year-old child who reports that the child is waking up at night with nightmares. Which of the following intervention