texasliz texasliz

30-11-2016
Mathematics

contestada

What are two ways that graphing a linear inequality is different from graphing a linear equation?

Respuesta :

kitcat2611 kitcat2611

30-11-2016

One way is that an inequality can have a dotted or solid line and another way is that you shade one side of the on an inequality.

Answer Link

Otras preguntas

determine whether you are accelerating as Earth rotates once every 24h

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Please help me, I promise I will give brainliest to the first answer, I dont care if there is no explanation, please just give the right answer

Why do water molecules stick to each other? A. They are polar and form covalent bonds. B. They are nonpolar and form hydrogen bonds. C. They are nonpolar and fo

11x-7y=-28 what is the slope intercept form

2. A statistics student plans to use a TI-84 Plus calculator on her final exam. From past experience, she estimates that there is 0.92 probability that the cal

which point is not on a graph of the line 2x-y=-1

Identify the following sentence as simple, compound, complex, or compound-complex.

How did Abraham Lincon died

Which of the following was a weakness of the Articles of Confederation? Congress could not declare war Congress could not suppress rebellion Congress could not