rhodeskids1 rhodeskids1
  • 03-03-2021
  • Mathematics
contestada

Please figure these all out quick i do not understand i need it done asap

Please figure these all out quick i do not understand i need it done asap class=
Please figure these all out quick i do not understand i need it done asap class=
Please figure these all out quick i do not understand i need it done asap class=
Please figure these all out quick i do not understand i need it done asap class=
Please figure these all out quick i do not understand i need it done asap class=

Respuesta :

creamyt05 creamyt05
  • 04-03-2021

Answer:

1. undefined

2. zero

3. positive

4. negative

5. 4/3

Answer Link
fox907
fox907 fox907
  • 04-03-2021

Answer:

1. undefined

2. zero

3. positive

4. negative

5. 4/3

Step-by-step explanation:

Hope this helps ;)

Answer Link

Otras preguntas

f(x)= 4/-x-2+2 h(x)=-1/x+3
The two triangles in the figure below are similar triangles. Solve for x.128846O 810O not enough information
I need help with part b and part c but I have to answer part b first
This is. A different one- Apex You can use an _____ to divide a fraction by a fraction
The length of Rectangle A is 7x + 3. The length of Rectangle B is 5x - 4. Given the twoRectangles are congruent, what is the value of x?Type your answer...
The left and right page numbers of an open book are two consecutive integers whose sum is 235 find these page numberThe two page numbers are ?
THE SYSTEM OF EQUATIONS 3X-4Y=13 -6X+8Y=4HAS HOW MANY SOLUTIONS?
1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts): Amino ac
a certain shade of pink is created by adding 3 cups of red paint to 12 cups of white paint. a. how many cups of red paint should be added to 1 cup of white pain
x + y = -34x + 4y = - 12.Solve the system of linear equations by graphing