kittymeows295 kittymeows295

02-03-2021
Mathematics

contestada

what is the missing length?

what is the missing length class=

Respuesta :

mustafaraid64ozfcim mustafaraid64ozfcim

02-03-2021

7.9^2 + 8.5^2= sqrt 134.66 = 11.60 ft

Answer Link

Otras preguntas

In a fruit punch, Sally mixed 3 3/4 cups of grape juice, 2 1/2 cups of pineapple juice and 6 2/3 of ginger ale. How many cups of punch did she have?

PLEASE HELP ME!! What was the name of the system developed by FDR Roosevelt during the Great Depression to aid lower income people? B) Medicare C) M

HR contains six red chili beans for green jellybeans and four blue jelly beans if we choose a jellybean then another jellybean without putting the first time ba

What are at least three differences between apes and humans in the cranium and teeth?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what played a great role in the kansan nebraska act

(60) Points HeLp asap 5 questions

Find the area bounded by the curves x = y2 - 4y and x = 2y - y2. Your work must include an integral in one variable.

if you work in an adolescent oncology youth cancer office will the doctor more likely see patients with Hodgkin lymphoma or neuroblastoma explain your answer

A rectangle has an area of 384 m. The length and the width of a rectangle are changed by a scale factor of 0.75. What is the area of the new triangle