ElhajiYassine4619 ElhajiYassine4619

28-02-2021
Biology

contestada

Pls, I need help with this! Biology Thank you :)

Pls I need help with this Biology Thank you class=

Respuesta :

sammnotfound sammnotfound

28-02-2021

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

Answer Link

Otras preguntas

Marnie purchased a dining room table and 6 chairs for $1,860.00 before discount and taxes. Kristen purchased a queen bed, dresser, 2 night stands, and a chest o

A revolving gas lantern enclosed in red and green glass, installed on a street corner in London in 1868 to regulate buggy and wagon drivers and pedestrians, was

Simplify 3/4*[12*4+(-16)]+(-20) A. 4 B. -44 C. 44 D. 16 No matter what I do, I just can't get any of these answers. I got 27 then -5 when I did it differently

if a kilogram of wheat flower is $6.What is the cost of 400 grams of flour

The base of a triangle is one-third as long as its height. If the area of the triangle is 54 square meters, how long is its base?

Find the first five terms of the sequence. a(n)= 3/5

show the cause and effect of the battle of fallen timbers...

describe how the life of a teen parent differs from the life of a teen without a child.

Ollie drank 3/4 of a 16 fluid ounce bottle of juice how many fluid ounces are left

How many kilojoules of heat are required to heat 1.37kg of water from 21.3 to 89.5

ACCESS MORE EDU ACCESS