Paolalandecho30
Paolalandecho30 Paolalandecho30
  • 03-02-2021
  • Mathematics
contestada

hello um I need sum help with this question would you mind helping?​

Respuesta :

24ereeves 24ereeves
  • 03-02-2021

Answer:

sure what do you need help with

Step-by-step explanation:

Answer Link
hughes1234567890
hughes1234567890 hughes1234567890
  • 03-02-2021

Answer:

What is the question?????

Step-by-step explanation:

Answer Link

Otras preguntas

I=$310 P=$1,000 t=5 years
The 1954 supreme court case that ruled racially segregated school systems "inherently unequal" was
The incline of a roller coaster is 2 times as long as its elevation, and the horizontal length of the roller coaster is 11 m more than the elevation. what is th
Determine the total time that must elapse until only 1/16 of an original sample of th-234 remains unchanged.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil
the push or pull that exists between interacting objects is
Describe why plant cells are rigid:
can you guys help me with this simple math problem ?
Using the images or terms, describe how parts of a cell interact to export proteins.