tippyco10 tippyco10

21-01-2021
Biology

contestada

Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?

Respuesta :

Sameerzul23 Sameerzul23

21-01-2021

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

Answer Link

Otras preguntas

What is the purpose of checks and balances in the federal government? a. It allows the government to check for errors when creating laws. b. It keeps one branch

A speech community is a group of people who speak the same language

A situation in which an adult patient understands the risks involved in not having a procedure or treatment performed is known as:

Research indicates that the _____________ of ethics training is associated with positive impacts on employee attitudes and behaviors.

50 POINTS AND BRAINLIEST!!! ________________________________________________________________________________ What three distinctly Spanish cultural phenomena ar

Birthweights at a local hospital have a normal distribution with a mean of 110 oz. and a standard deviation of 15 oz. what z-value corresponds to a birthweight

A set of cards contains the numbers 1 through 20. Mathieu chooses a card a random, records the number of the card, and then returns the card to the set. He cond

________ is said to have occurred if a certificate of limited partnership was not properly filed.

Which statement best describes the electrons in this illustration ? A) The electrons are negatively charged particles located outside the nucleus B) The electr

What is the minimum value of the parabola y= x^2+5x

ACCESS MORE