figueroamelany316 figueroamelany316

19-12-2020
Biology

contestada

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Respuesta :

raduoprea160 raduoprea160

19-12-2020

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

ACCESS MORE

Otras preguntas

Mark is at a toy store with his friends, his mom gave him 50$ to spend there. mark wants to buy three things how much will it cost? drone 17$ skate board 19$ fo

The following equations for force were re- written in terms of only base dimensions, with the exception of an unknown parameter, k. Determine the required dimen

identifying functions worksheet

How many moles of Ba(NO3)2 are there in 0. 25 L of a 2. 00 M Ba(NO3)2 solution? Use Molarity equals StartFraction moles of solute over liters of solution EndFra

In 2010, Fernando paid $1,810 in federal income tax. In 2011, he paid $816. What is the percent of decrease in the amount paid

were the people of kiev forced to get baptized

What is sodium fluoride?

Simplify −4(p – 5) + 9(3p) – 11. 23p + 9 −4p – 5 + 12p – 11 −4p – 20 + 12p – 11 −4p – 20 + 27p – 11

30% of the members of a tennis club are pensioners. 36 members are pensioners. how many members are there in total?

In ____ reasoning, the truth of the conclusion is contained in the premises. Select one: a. counterfactual b. abductive c. Deductive d. inductive