jeanty768 jeanty768

21-09-2016
Mathematics

contestada

Justin made $204 for 12 hours of work. At the same rate, how much would he make for 18 hours of work?

Respuesta :

Аноним Аноним

21-09-2016

$306. He makes $17 an hour

Answer Link

ACCESS MORE

Otras preguntas

If a turtle looses its shell is it naked or homeless? I need to know !

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

in which direction does light oscillate if it is reflected off a shiny transparent surface

Napoleon signed the concordat because he: a. was a devout catholic. b. believed that defeating the english navy was impossible. c. believed that his invasion

What is the value of s in the equation 3r = 10 + 5s, when r = 10?

Which stis are monitored by federal mandatory reporting laws?

Hich of the following is the best way to prevent sports injuries? a. see a doctor as soon as possible. b. stop doing the sport that caused the injury. c. kno

Find the mean, variance, and standard deviation of the binomial distribution with the given values of n and p.

The introspection method was invented by _____________. John Watson William James Wilhelm Wundt Sigmund Freud

In the concentration camps, the people least likely to be executed were a. children. c. the 6iest. b. women. d. the weakest.