blackoutstar9571 blackoutstar9571
  • 18-06-2020
  • Mathematics
contestada

Martin uses 5/8 Of a gallon of paint to cover 4/5 Of a wall.What is the unit rate in which Martin paints in walls per gallon

Respuesta :

maxwellekoh
maxwellekoh maxwellekoh
  • 18-06-2020

Answer:

32/25 walls per gallon.

Step-by-step explanation:

Martin uses 5/8 Of a gallon of paint to cover 4/5 Of a wall

Hence 1 gallon would be 4/5÷5/8=

4/5 × 8/5= 32/25 walls per gallon.

Answer Link

Otras preguntas

what is the surface area of the cone? •144pi in sq. •132pi in sq. •36pi in sq. •60pi in sq.
Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed f
If the velocity of a motorcycle increases from 30 mis too 50m/s in 10 seconds what will be the acceleration of motorcycle?​
Division B, another division in the company, would like to buy this part from Division A. Division B is presently purchasing the part from an outside source at
Suppose the lead time is 3 operating days, and that the superstore wishes to maintain instock probability of 90%. The demand in each day is normal distributed w
what are the different types of society on the basis of the successive development of hunan civilization ? briefly sketch the characteristics of the primitive s
Which side of XYZ is the longest? A. xyB. xzC. yzD. cannot be determined​
convert 14.72 kg to ____ mg
Find y when = 22, if y varies directly as x, and y = 39 when x = 7.
An electron is moving through a magnetic field whose magnitude is 83 x 10-5 T. The electron experiences only a magnetic force and has an acceleration of magnitu