BLAHBLAHanser BLAHBLAHanser

03-12-2019
Mathematics

contestada

★★CHRISTMAS SPECIAL★★

Can someone give me a hand here ⍨ ?

I will give brainliest and Thanks plus 5 starsッッ

CHRISTMAS SPECIAL Can someone give me a hand here I will give brainliest and Thanks plus 5 starsッッ class=

Respuesta :

twalker2406 twalker2406

03-12-2019

Answer:

A

Step-by-step explanation:

Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Given that triangle LMN has side lengths of 20 inches, 10 inches, and 12 inches, prove triangle LMN is a right triangle. Explain by applying the Converse of the

According to Fodor, in the functionalist view the psychology of a system depends not on the stuff it is made of but on _____. A. what psychologists say about th

A 45-mH ideal inductor is connected in series with a 60-Ω resistor through an ideal 15-V DC power supply and an open switch. If the switch is closed at time t =

can you find the conditional sentences? A lo largo de esta canción hay varias oraciones condicionales. Rellena la tabla con las oraciones condicionales que apar

If a-b = 4 and ab = 60, what is the value of a + b?

Help me first on that answers wins brainliest!

Kyle is planning to take a roadtrip. After he makes his plans, he has to make some unexpected auto repairs. Also, he sees the price of gas has gone up. Which of

public class Point { private int x; private int y; public void setx(int x) this.x = x; public void setY(int y) this.y=y; public void setXY(int x, int y) X=y; ys

How would I solve this?