Destineed6244 Destineed6244

20-11-2019
Law

contestada

CRIMINOLOGY

HELP FAST!!

Why are victims considered the first "Gatekeepers" of the criminal justice system?

What did the Wickersham Report study?

Respuesta :

amoonful amoonful

21-11-2019

- They are considered gatekeepers because they make the initial decision of wether or not they think a crime has occurred, then they make they decision to report the act to the system if they think a law was broken.

-The Wickersham Report studies “the administration of justice”

Answer Link

helloitsme66 helloitsme66

21-11-2019

Answer: They tell if the crime has accured

Answer Link

Otras preguntas

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Property-tax revenues for the county were reported at $770,000 on its governmental funds statement, but property-tax revenues on the county's government-wide st

Over time, a river cut through a field where some mice lived and some birds were nesting. Tell over time why the mice developed into 2 different species, but t

Elsie loves to garden the width of her current garden is half the length. Elsie wants to increase both the width and the length of her garden to triple the size

In As I Lay Dying, what was Anse hoping to pay for someday?A.New windowsB.Addie's medical billsC.New teethD.His youngest son's education

When Sony launched its new PS4 gaming system, the product was sold as a package that included the game console, game controllers, wireless headset, and one vide

The Reds and the Cubs are playing 3 games. In each game the probability that the Reds win is 0.54. The probability of the Reds winning is not affected by who ha

g A review of Parson Corporation's accounting records found that at a volume of 146,000 units, the variable and fixed cost per unit amounted to $8 and $5, respe

Steve has estimated the cash inflows and outflows for his dental firm for next year. The report that he has prepared summarizing these cash flows is called a: A

What is the definition of suffrage