nurserodney3otas5q nurserodney3otas5q

19-09-2019
English

contestada

circle the subject and underline the predicate . the mischievous puppy chewed up all the flip flops

Respuesta :

kyjaah4ever kyjaah4ever

19-09-2019

Answer:

The subject is the puppy and the predicate is chewed

Explanation:

Subject is what the Sentence is about and Predicate is a verb stating something about the subject.

Answer Link

ACCESS MORE

Otras preguntas

What type of reaction does each of the following equations represent? NH4OH>NH3+H20 A. Single replacement B. Decomposition C. Double replacement

All members of the alkene series of hydrocarbons have the general formula: Select one: a. CnH2n-2 b. CnH2n+2 C. CnHn d. CnH2n

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Does anyone know #3-4 help

Draw a line representing the "rise" and a line representing the "run" of the line. State the slope of the line in simplest form.

how much cost to make 1 ruppe coina. 1.11b.1.22c. 2.56d. 4.25

i gotta write a short story for my English class I decided on writing a romance story. i just have a question for all you amazing and beautiful and strong peopl

A plane at an altitude of 7000ft is flying in direction of an island. If they angel of depression is 21 from the plane to the island, what is the horizontal dis

what did germany do to make britain enter WW1 in august 1914

Fill the blanks plz