oceanwave87 oceanwave87

27-03-2019
Biology

contestada

which of the following best explains why organisms of the same species that become isolated eventually become different from each other over time

Respuesta :

awesomecatladypcal3x awesomecatladypcal3x

28-03-2019

Answer: They are exposed to different environments

When animals are isolated from each other and put in different environments, they react to their environment differently and this causes them to adapt differently.

Answer Link

Otras preguntas

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

what did Shah jahan name the Delhi

Chinggis Khan Group of answer choices carried Chinese governmental techniques to Persia. created a tightly structured centralized government. did not establish

Suppose the initial position of an object is zero, the starting velocity is 3 m/s and the final velocity was 10 m/s. The object moves with constant acceleration

Signs and symptoms of aplastic anemia include which of the following? (Select all that apply.) Fever Pallor Dyspnea Petechiae Bradycardia

Write the equation of the line that contains (8,0) and is parallel to the line -3x+4y=4

If a company uses LIFO, a LIFO liquidation causes a company's income taxes to increase:_______ a. When inventory purchase costs are rising. b. LIFO liquidation

Consider the strategic games described below. In each case, state how you would classify the game according to the six dimensions outlined in the text. (i) Are

Please help meeee > THANK YOU!!!!!

Though farming still exists in the ridge and valley region, it is best known as a(n) ____ center of Georgia. A.industrial B.livestock C.shipping D.tourist

ACCESS MORE EDU ACCESS Universidad de Mexico