B. During DNA replication, an insertion mutation caused an extra nucleotide to be added to the DNA
sequence below. Write the new sequence in DNA triplets, then the complementary mRNA codons, and finally the resulting amino acids.
DNA Sequence: TTTGGAGACACCATAATCGCAAATC
DNA triplets: TTT, GGA, GAC, [Answer]
mRNA codons: [Answer]
Amino Acids: [Answer]
C. What was the overall result of the insertion mutation when compared to the original DNA sequence? What effects could this type of mutation have on an entire organism?
[answer]
