WillSisson5319 WillSisson5319
  • 17-12-2022
  • Computers and Technology
contestada

It is a good idea to maintain duplicate records in different locations for ease of access.a. Trueb. False

Respuesta :

ACCESS MORE

Otras preguntas

The difference between a metaphor and a simile is that a simile
Jane found that 25% of the total number of teenagers surveyed like sandwiches. If 50 teenagers like sandwiches what is the total number of teenagers that Jane s
what is the perimeter of this polygon
A dentist would apply for a license with the______ . a.state government b.federal government c.city government d.country government
Can anyone help me with geography
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
What is the definition of the German word Volksblatt?
Which step is missing from the repetition strategy? Read, Write, Say, Revisit
Which phrase best completes the following sentence to give it an objective tone? When we moved to a new town, _____ to introduce themselves. A. not a single
How does the use of credit influence businesses and the economy?