task 1: reading dna files the first task is to read a dna text file into memory. a dna text file contains only a single segment of dna in ascii format that looks like this: agacgggttaccatgactatctatctatctatctatctatctatctatcacgtacgtacgtatcgagatagatagatagatagatcctcgacttcgatcgcaatgaatgccaatagacaaaa you must implement two functions named read dna and dna length. given the name of a file, the read dna function reads the text file and returns the dna sequence as a python string. the dna length function returns the length of the dna sequence contained in a given dna file name. the dna length function must use the read dna function to get the dna string and then compute the dna length. here are the two functions along with their docstrings you need to implement:
